{"id":30504,"date":"2022-02-23T15:40:09","date_gmt":"2022-02-23T20:40:09","guid":{"rendered":"https:\/\/web.uri.edu\/riinbre\/?page_id=30504"},"modified":"2026-04-27T15:28:12","modified_gmt":"2026-04-27T19:28:12","slug":"mic-miseq","status":"publish","type":"page","link":"https:\/\/web.uri.edu\/riinbre\/mic\/mic-services-and-resources\/mic-sequencing-services\/mic-miseq\/","title":{"rendered":"MIC MiSeq"},"content":{"rendered":"<h1 class=\"post-title entry-title\">Next Generation Sequencing<\/h1>\n<div class=\"entry-content\">\n<ul>\n<li>Fees<\/li>\n<li>Standard Procedures<\/li>\n<\/ul>\n<p style=\"text-align: left\" align=\"center\"><strong><em>Illumina MiSeq Next Generation Sequencing<\/em><\/strong><\/p>\n<p>The Illumina MiSeq is a benchtop instrument that utilizes a single-lane flow cell and a reagent cartridge supplied in kit form.<\/p>\n<p>The MiSeq is an integrated instrument that performs clonal amplification, sequencing, and data analysis (base calling, alignment, variant calling, and reporting) in a single run.&nbsp; The sequential interrogation of bases allows for the flexible adjustment of read length during a run.&nbsp;<\/p>\n<p><strong><em>MiSeq NGS Fees<\/em><\/strong><\/p>\n<p>The fee for NGS sequencing on the Illumina MiSeq is based on the kit used and is shown in the following table.<\/p>\n<table border=\"1\" width=\"492\" cellspacing=\"0\" cellpadding=\"0\">\n<tbody>\n<tr>\n<td valign=\"top\" width=\"180\">\n<p align=\"center\"><strong>MiSeq Sequencing Kit<\/strong><\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\"><strong>Kit Cost<\/strong><\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\"><strong>Shipping &amp; Consumables<\/strong><\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\"><strong>User Cost<sup>\u2020<\/sup><\/strong><\/p>\n<\/td>\n<\/tr>\n<tr>\n<td valign=\"top\" width=\"180\">\n<p align=\"center\">50 cycle Reagent Kit v2<\/p>\n<p align=\"center\">MS-102-2001<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$846.50<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$50.00<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$896.50<\/p>\n<\/td>\n<\/tr>\n<tr>\n<td valign=\"top\" width=\"180\">\n<p align=\"center\">150 cycle Reagent Kit v3<\/p>\n<p align=\"center\">MS-102-3001<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$939.55<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$50.00<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$989.55<\/p>\n<\/td>\n<\/tr>\n<tr>\n<td valign=\"top\" width=\"180\">\n<p align=\"center\">300 cycle Reagent Kit v2<\/p>\n<p align=\"center\">MS-102-2002<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$1,085.85<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$50.00<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$1,135.85<\/p>\n<\/td>\n<\/tr>\n<tr>\n<td valign=\"top\" width=\"180\">\n<p align=\"center\">500 cycle Reagent Kit v2<\/p>\n<p align=\"center\">MS-102-2003<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$1,217.90<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$50.00<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$1,267.90<\/p>\n<\/td>\n<\/tr>\n<tr>\n<td valign=\"top\" width=\"180\">\n<p align=\"center\">600 cycle Reagent Kit v3<\/p>\n<p align=\"center\">MS-102-3003<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$1,590.30<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$65.00<\/p>\n<\/td>\n<td valign=\"top\" width=\"104\">\n<p align=\"center\">$1,655.30<\/p>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n<p class=\"smalltxt\"><sup>\u2020 <\/sup>Prices are subject to change due to the cost of reagent kits from Illumina. &nbsp;Last revised: 11\/10\/2020.&nbsp; Note these costs are for the reagent kit only; charges will vary due to library preparation and\/or required quality control assays. In addition, <strong>each MiSeq run will incur an instrument use fee<\/strong> as set forth in the RI-INBRE rates. For specific pricing, please request a quotation at: jatoyan@uri.edu.<\/p>\n<p class=\"smalltxt\"><strong><em>MiSeq NGS Submission Information<\/em><\/strong><\/p>\n<p align=\"center\">PLEASE CONSULT WITH THE SEQUENCING MANAGER (jatoyan@uri.edu) PRIOR TO PREPARING YOUR SAMPLES FOR SUBMISSION!<\/p>\n<p><strong>Submitting Genomic DNA for Library Prep and MiSeq NGS<\/strong>:<\/p>\n<ul>\n<li>Samples submitted for PrepX library preparation should ideally contain a minimum concentration of 35 ng\/\u00b5l of high-quality DNA in a minimum of 60 \u00b5l of 10 mM Tris-HCl (pH 8.5). &nbsp;See below for details on how to quantify your sample. &nbsp;EDTA should NOT be present as this may inhibit downstream reactions.&nbsp; Contact the MIC if you are unable to supply this concentration and\/or amount of DNA as modifications are often possible.<\/li>\n<li>Determine your DNA quality by gel electrophoresis to show a single band indicating no contaminating RNA.<\/li>\n<li>DNA quality should also be measured by spectrophotometry to yield an A260\/280 of ~1.8 and and A260\/230 of ~1.5. Smaller ratios indicate the presence of contaminating proteins and\/or organic chemicals. We suggest you consider using the Nanodrop 8000 instrument in CBLS 352.&nbsp; The Nanodrop spectrophotometer uses only 1 \u00b5l of sample to determine both the concentration and purity of DNA and can measure up to 8 samples at a time.<\/li>\n<li>Determine your DNA quantity by&nbsp; Invitrogen Qubit fluorometer (also located in 352 CBLS). &nbsp;For a small fee, the MIC can determine your DNA quantity using the Qubit prior to library construction.<\/li>\n<li>For a Sample ID, the tube should be labeled with the investigator\u2019s three initials and three numbers (i.e. PWJ001). &nbsp;Please increase the number with each submission.<\/li>\n<\/ul>\n<p><strong>Submitting a User Prepared Library for MiSeq NGS:<\/strong><\/p>\n<p>Please contact the MIC prior to library preparation in order to confirm details about what kind of sample will be submitted, how it will be prepared, and what kind of data can be expected from the MiSeq. This will also allow us to provide guidelines for sample preparation and the proper choice of indices if you are planning to multiplex your samples. &nbsp;Indexed adapters are available for purchase from the MIC.<\/p>\n<ul>\n<li>Samples should contain a minimum concentration of 4 nM functional library DNA (15 \u00b5l minimum) as determined by qPCR.&nbsp;&nbsp; (Note: nM = nanomolar not ng\/\u00b5L).&nbsp; If it is possible to submit a higher concentration, please do so, and we will dilute your library if necessary. &nbsp;If you cannot accurately quantify your library, please contact the MIC prior to submission.<\/li>\n<li>The MIC will perform a BioAnalyzer QC on all libraries submitted for Illumina MiSeq sequencing as well as a qPCR functional library quantification (KAPA Biosciences) as described below. &nbsp;If we determine your sample may be too dilute to cluster properly, we will inform you before proceeding with the MiSeq run.<\/li>\n<\/ul>\n<p><strong>Important notes about Illumina MiSeq sequencing:<\/strong><\/p>\n<p><strong>Choice of indices:&nbsp; <\/strong>Illumina sequencers use a green laser to sequence G\/T nucleotides and a red laser to sequence A\/C nucleotides. At least one of the two nucleotides for each color channel should be present at each cycle of the index read to ensure accurate image registration. &nbsp;This is accomplished by selecting index combinations that display this green\/red channel diversity at each cycle. &nbsp;It is important to maintain color balance for each base otherwise index read sequencing could fail due to registration issues and the ability to demultiplex pooled samples may be impacted.<\/p>\n<p>If you are planning to submit pre-made libraries that you would like multiplexed, please contact the MIC for guidelines to help you choose the best combination of indices.<\/p>\n<p><strong>Sequencing a balanced library:&nbsp; <\/strong>In order for the MiSeq software to properly identify bases during reads, it is important that your library be \u201cbase balanced.\u201d The GC content of a sample for de novo assembly or resequencing should be between 40 and 60%. If you do not expect this to be the case, please let us know.<\/p>\n<p><strong>Low diversity libraries:&nbsp; <\/strong>Mono templates and samples with homologous regions, such as PCR amplicons or RADSeq libraries, may require a 10-20% spike of phiX control DNA. This will maintain color balance, allowing the software to process samples correctly, but will decrease the amount of coverage or bases called.<\/p>\n<p><strong>Data transfer and assembly:<\/strong> &nbsp;Users may access their data and view run metrics from Illumina\u2019s BaseSpace cloud storage upon completion of the run (see MiSeq workflows and file formats below).&nbsp; This requires the user to sign up for a free BaseSpace account through Illumina.com.<\/p>\n<h4>Sample Library Preparation<\/h4>\n<p style=\"text-align: left\" align=\"center\"><strong><em>Library Preparation<\/em><\/strong><\/p>\n<p>The MIC\u2019s NGS library preparation services are targeted for Illumina platforms. The <strong>Illumina MiSeq at URI<\/strong> has the capacity to generate up to 50 million paired-end reads or 15 Gb of high-quality data from a 2 x 300 bp run in 65 hours.<\/p>\n<p style=\"text-align: left\" align=\"center\"><strong><em>Whole Genome Library Preparation<\/em><\/strong><\/p>\n<p style=\"text-align: left\" align=\"center\"><em><strong>PrepX Library Preparation<\/strong><\/em><\/p>\n<p><strong>DNA Fragmentation<\/strong>:&nbsp; PrepX libraries are prepared by first fragmenting genomic DNA into a size range that can be run on the Illumina instruments.&nbsp; We use a Covaris S220 high performance focused ultra-sonicator for this shearing step.&nbsp; The S220 uses a sample size of 50 or 130 \u00b5l, and the shearing process is completed in less than a minute.&nbsp; The V3 MiSeq chemistry and imaging technology limits the readable portion of the DNA fragments to 600 total bases.&nbsp; The first 300 bases are read on the MiSeq during Read 1, and in Read 2 an equivalent number of bases are read from the other direction.&nbsp; Therefore, the target fragment size for the MiSeq 600 cycle V3 kit is normally 500-700 bp.&nbsp; The target size for the HiSeq 2000 is generally much less.<\/p>\n<p><img loading=\"lazy\" decoding=\"async\" class=\"aligncenter size-medium wp-image-447\" src=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/SampleLibraryimage1-300x262.jpg\" alt=\"\" width=\"300\" height=\"262\"><\/p>\n<p><strong>Library Construction<\/strong>:&nbsp; After the shearing step, the DNA fragments need to be ligated with two adaptors (P5 &amp; P7) that allow the final product to bind or hybridize to short oligos on the surface of the Illumina flow cell.&nbsp; The adaptors used in this process can be indexed or barcoded with short sequences of 6-8 bases to enable multiplexing of more than one sample in the same run.&nbsp; We normally use NEXTflex DNA Barcodes indexed adaptors from BIOO Scientific for this purpose.&nbsp; The following diagram is a generalized scheme illustrating the steps in library preparation<\/p>\n<p><img loading=\"lazy\" decoding=\"async\" class=\"aligncenter size-medium wp-image-450\" src=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/SampleLibraryimage2-191x300.jpg\" alt=\"\" width=\"191\" height=\"300\"><\/p>\n<p>At this time, we are using a <a title=\"Apollo 324 link\" href=\"http:\/\/www.wafergen.com\/products\/apollo-324\" target=\"_blank\" rel=\"noopener noreferrer\">Takara Bio Apollo 324<\/a> robot for library preparation. &nbsp;This system automates end-repair, A-tail addition, adapter\/index ligation, and bead-based size selection.&nbsp; Up to 32 sample libraries can be prepared in 24 hours. &nbsp;The following image shows the layout of the Apollo 324 deck.<\/p>\n<p><img loading=\"lazy\" decoding=\"async\" class=\"aligncenter size-medium wp-image-448\" src=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/SampleLibraryimage3-300x170.jpg\" alt=\"\" width=\"300\" height=\"170\"><\/p>\n<p style=\"text-align: left\" align=\"center\"><em><strong>Quality Control<\/strong><\/em><\/p>\n<p><strong>BioAnalyzer QC<\/strong>:&nbsp; Every library we prepare must be evaluated in order to determine the concentration and size distribution of the final product.&nbsp; The MIC uses an Agilent BioAnalyzer with High-Sensitivity DNA chips for this procedure.&nbsp; The BioAnalyzer \u201clab-on-a-chip\u201d technology uses capillary electrophoresis to generate an electropherogram that shows the size distribution of nucleic acid molecules in comparison to an internal standard and ladder.&nbsp; The final library must meet the specifications of the Illumina instrument before proceeding with NGS analysis.&nbsp; In the following BioAnalyzer electropherogram a library produced by an Apollo 324 run shows the average size is 676 bp with a concentration of ~6 ng\/\u00b5l.<\/p>\n<p><img loading=\"lazy\" decoding=\"async\" class=\"aligncenter size-medium wp-image-449\" src=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/SampleLibraryimage4-300x238.png\" alt=\"\" width=\"300\" height=\"238\"><\/p>\n<p><strong>Functional Quantification<\/strong>:&nbsp; Since all DNA molecules in the final library may not have adapters linked to them, we must perform a qPCR assay to determine the functional concentration of DNA fragments present.&nbsp; The functional library will then be diluted to the proper concentration for formation of an optimal cluster density for each instrument.&nbsp; We use the KAPA Biosciences Illumina chemistry kit with our Roche LightCycler 480 qPCR instruments.&nbsp; This kit contains primers specific to the linked Illumina adapters and the qPCR analysis is run in triplicate along with a series of six standards.<\/p>\n<p style=\"text-align: left\" align=\"center\"><strong><em>Library Preparation Fees<\/em><\/strong><\/p>\n<p>In general, whole genome NGS library preparation follows the sequence of steps listed below.&nbsp; If a sample requires further processing, there may be an additional cost.&nbsp; Submitters will receive the results of the High Sensitivity Chip QC run as well as data from the KAPA functional quantification assay.&nbsp; If our qPCR assay determines that an insufficient concentration of DNA library is present, we will notify the submitter before proceeding with a MiSeq run.&nbsp; Should the submitter want to proceed to sequencing with a low functional library concentration, we will require a signed waiver stating that payment will be made regardless of the outcome.<\/p>\n<p><strong>Request a Quotation<\/strong>:&nbsp; To obtain the most accurate pricing for library preparation based on your sample requirements, please contact the MIC at 401-874-5919 or <a href=\"mailto:jatoyan@uri.edu\">jatoyan@uri.edu<\/a> and request a quote.<\/p>\n<h4>Amplicon Library Preparation and Analysis<\/h4>\n<p style=\"text-align: left\" align=\"center\"><em><b>Sequencing Customized Amplicon Libraries\/16S Metagenomics<\/b><\/em><\/p>\n<p>The MIC offers a two-step PCR method based on Illumina\u2019s demonstrated <a href=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/16s-metagenomic-library-prep-guide-15044223-b.pdf\" target=\"_blank\" rel=\"noopener noreferrer\">16S Metagenomic Sequencing Library Preparation Protocol<\/a><i> <\/i>for the preparation of NGS-ready fragments of amplicon DNA derived from diverse sources. &nbsp;While any gene can be chosen for study, the analysis of prokaryotic 16s rRNA is a common method used to identify and compare bacteria present within a given sample. &nbsp;This method has been used to evaluate bacterial diversity in many environments, allowing researchers to characterize microbiomes from samples that are otherwise difficult or impossible to study. The MiSeq software offers specific data analysis for 16s rRNA samples, returning classifications down to the species level.<\/p>\n<p><b>Protocol<\/b><b>:<\/b><\/p>\n<p>A 2-step PCR protocol is used that requires only a single set of non-indexed primers for each amplicon to be sequenced, regardless of the number of samples to be multiplexed. This protocol provides investigators with a low-cost method as an alternative to purchasing individual sets of indexed primers for each sample they wish to multiplex. Because the MIC will perform the second round of PCR, the cost of the Nextera indices and adapters used can be divided among several submitters.<\/p>\n<p>An investigator provides amplicons tailed with an overhanging adapter sequence (see Sequences of Round 1 PCR Primers below) that have been cleaned and verified to be the expected size and free of primer dimer by gel electrophoresis. The best method for PCR cleanup\/primer dimer removal is the use of Ampure XP beads (please contact the MIC for the recommended protocol). If this is unavailable or new to your lab, the MIC will perform this service for a fee. Ideally, when selecting or designing primers, the amplicon size (exclusive of adapter overhang sequence) should allow for an ~100 bp overlap when sequencing, i.e. the MiSeq 600-cycle kit (2\u00d7300 bp reads) would be appropriate for a 500 bp amplicon. <strong>Please note that we currently&nbsp;recommend using V3 chemistry kits (150- or 600-cycle) for amplicon libraries as they generate much higher quality data.<\/strong><\/p>\n<p><b>What to submit:<\/b><\/p>\n<p>If submitting cleaned PCR amplicons, the concentration of each sample should ideally be \u2265 5 ng DNA per \u00b5l in 20 \u00b5l of PCR water or 10 mM Tris (elution buffer), as 50 ng of amplicon DNA needs to be added to the Round 2 PCR reaction. Investigators submitting samples for Ampure XP cleanup by the MIC should perform their PCR reaction in a 50 ul volume and run 5 ul of their sample on an agarose gel to verify a single amplicon of the correct size.<\/p>\n<p>Samples must be submitted in PCR strip tubes with individually attached lids (e.g. USA Scientific 1402-4700). Samples should be numbered sequentially.<\/p>\n<p>After submission or cleanup, samples will be quantified with the Qubit high sensitivity DNA kit to verify the concentration. &nbsp;Indexing does not occur until Round-2 PCR so it is imperative to maintain sample integrity during Round-1 PCR.<\/p>\n<p><b>Sequences of Round 1 PCR Primers:<\/b><\/p>\n<p>Forward Primer with Adapter Overhang:<\/p>\n<p>5\u2019 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG\u2010[locus-specific sequence]<\/p>\n<p>Reverse Primer with Adapter Overhang:<\/p>\n<p>5\u2019 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG\u2010[locus-specific sequence]<\/p>\n<p>Investigators wishing to follow Illumina\u2019s 16S protocol can choose to use the locus-specific sequences they recommend. These were selected from the Klindworth et al. as the most promising bacterial primer pair. Klindworth A, et al. (2013)<i> Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies.<\/i> Nucleic Acids Res 41(1). <strong>Please note<\/strong> that these primers are are recommended by Illumina and they have not been evaluated by the MIC.<\/p>\n<p><b>The full sequences of these primers (including the partial adapter overhang) are:<\/b><\/p>\n<p>16S Amplicon PCR Forward Primer:<\/p>\n<p>5\u2032 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG<\/p>\n<p>16S Amplicon PCR Reverse Primer:<\/p>\n<p>5\u2032 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC<\/p>\n<p>These primers can be ordered through any custom oligo service such as IDT. Illumina recommends using standard desalting purification when ordering the primer sets.<\/p>\n<p>After amplicon submission, the MIC will perform a second round of PCR (5-10 cycles) to attach Nextera indices and adapters (see Illumina diagram below). Round 2 PCR reactions are cleaned with Ampure XP, visualized by agarose gel electrophoresis, and selected samples are analyzed using the Agilent BioAnalyzer DNA1000 chip. Qubit quantification must be performed on all samples prior to pooling, and KAPA quantification will be performed on the final pooled library prior to loading on the MiSeq flow cell.<\/p>\n<p><a href=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/AmpliconStep-1.png\" rel=\"lightbox[30504]\"><img loading=\"lazy\" decoding=\"async\" class=\"size-full wp-image-738 aligncenter\" src=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/AmpliconStep-1.png\" alt=\"\" width=\"441\" height=\"293\"><\/a><a href=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/AmpliconStep-2.png\" rel=\"lightbox[30504]\"><img loading=\"lazy\" decoding=\"async\" class=\"size-full wp-image-739 aligncenter\" src=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/AmpliconStep-2.png\" alt=\"\" width=\"438\" height=\"287\"><\/a><\/p>\n<p><b>Amplicon library preparation workflow<\/b><b>:<\/b><\/p>\n<p><a href=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/Amplicon_workflow.png\" rel=\"lightbox[30504]\"><img loading=\"lazy\" decoding=\"async\" class=\"aligncenter size-full wp-image-989\" src=\"https:\/\/web.uri.edu\/wp-content\/uploads\/sites\/72\/Amplicon_workflow.png\" alt=\"Amplicon_workflow\" width=\"348\" height=\"468\"><\/a><strong>Request a Quotation<\/strong>:&nbsp; To obtain the most accurate pricing for library preparation based on your sample requirements, please contact the MIC at 401-874-5919 or <a href=\"mailto:jatoyan@uri.edu\">jatoyan@uri.edu<\/a> and request a quote.<\/p>\n<h4 style=\"text-align: left\" align=\"center\"><em><b>MiSeq NGS Data Flow<\/b><\/em><\/h4>\n<p>Data from MiSeq runs are distributed through <a title=\"Basespace\" href=\"https:\/\/basespace.illumina.com\" target=\"_blank\" rel=\"noopener noreferrer\">BaseSpace<\/a>, Illumina\u2019s genomics cloud computing environment. &nbsp;To access BaseSpace, investigators need to sign up for a free Illumina account.&nbsp; For more information see the <a title=\"BaseSpace User Guide\" href=\"https:\/\/support.basespace.illumina.com\/\" target=\"_blank\" rel=\"noopener noreferrer\">BaseSpace User Guide<\/a>.<\/p>\n<p>During the MiSeq run, data is uploaded to BaseSpace as it is generated.&nbsp; MiSeq Reporter (MSR), running in BaseSpace, demultiplexes and analyzes the data upon completion of the run. &nbsp;The MIC will evaluate the run metrics and send an email containing the BaseSpace run and project links to the investigator. &nbsp;These links allow the investigator to download FASTQ data files for analysis with other software or choose from several analysis applications within BaseSpace. &nbsp;These links can be shared with anyone the investigator chooses, allowing collaborators to access and download the data.<\/p>\n<\/div>\n","protected":false},"excerpt":{"rendered":"<p>Next Generation Sequencing Fees Standard Procedures Illumina MiSeq Next Generation Sequencing The Illumina MiSeq is a benchtop instrument that utilizes a single-lane flow cell and a reagent cartridge supplied in kit form. The MiSeq is an integrated instrument that performs clonal amplification, sequencing, and data analysis (base calling, alignment, variant calling, and reporting) in a [&hellip;]<\/p>\n","protected":false},"author":3192,"featured_media":0,"parent":29431,"menu_order":0,"comment_status":"closed","ping_status":"closed","template":"","meta":{"_acf_changed":false,"footnotes":"","_links_to":"","_links_to_target":""},"class_list":["post-30504","page","type-page","status-publish","hentry"],"acf":[],"_links":{"self":[{"href":"https:\/\/web.uri.edu\/riinbre\/wp-json\/wp\/v2\/pages\/30504","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/web.uri.edu\/riinbre\/wp-json\/wp\/v2\/pages"}],"about":[{"href":"https:\/\/web.uri.edu\/riinbre\/wp-json\/wp\/v2\/types\/page"}],"author":[{"embeddable":true,"href":"https:\/\/web.uri.edu\/riinbre\/wp-json\/wp\/v2\/users\/3192"}],"replies":[{"embeddable":true,"href":"https:\/\/web.uri.edu\/riinbre\/wp-json\/wp\/v2\/comments?post=30504"}],"version-history":[{"count":5,"href":"https:\/\/web.uri.edu\/riinbre\/wp-json\/wp\/v2\/pages\/30504\/revisions"}],"predecessor-version":[{"id":38010,"href":"https:\/\/web.uri.edu\/riinbre\/wp-json\/wp\/v2\/pages\/30504\/revisions\/38010"}],"up":[{"embeddable":true,"href":"https:\/\/web.uri.edu\/riinbre\/wp-json\/wp\/v2\/pages\/29431"}],"wp:attachment":[{"href":"https:\/\/web.uri.edu\/riinbre\/wp-json\/wp\/v2\/media?parent=30504"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}